Virus-like particles vaccine of porcine epidemic diarrhea virus spike 1 protein induces protective immunity challenge in piglets

pmc Biochem Biophys Rep Biochem Biophys Rep 3295 bbpr 101660999 Biochemistry and Biophysics Reports 2405-5808 Elsevier PMC13485654 PMC13485654.1 13485654 13485654 42620304 10.1016/j.bbrep.2026.102734 S2405-5808(26)00294-3 102734 1 Research Article Virus-like particles vaccine of porcine epidemic diarrhea virus spike 1 protein induces protective immunity challenge in piglets Li Zhiqiang Leezq5821@163.com a ⁎ Li Jie 2018807182@stu.njau.edu.cn a Cheng Jiahai 2020207012@stu.njau.edu.cn a Zhang Guigang zhangyuanshu_njau@163.com a Zhao Mingzhi lizq207@163.com a ⁎⁎ Wang Zhen 2022107007@stu.njau.edu.cn b a Jinyu Baoling Bio-pharmaceutical Co., Ltd., Hohhot, Inner Mongolia, 010111, China b Animal Disease Prevention and Control Center of Tuquan County, Xing'an League, Inner Mongolia, 137500, China ⁎ Corresponding author. Leezq5821@163.com ⁎⁎ Corresponding author. lizq207@163.com 9 2026 10 8 2026 47 515510 102734 26 10 2025 9 12 2025 30 7 2026 10 08 2026 20 08 2026 26 08 2026 © 2026 The Authors 2026 https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Porcine epidemic diarrhea virus (PEDV) is a highly contagious intestinal disease that impairs piglet growth and development, causing significant economic losses. Therefore, developing an effective vaccine is crucial for preventing and controlling PEDV. This study used a eukaryotic expression system to assemble S1 with Ferritin into virus-like particles (S1–F-VLP) via SpyTag-SpyCatcher and confirmed their immunogenicity and protective efficacy. The results showed no mouse deaths or sow abortions during S1–F-VLP vaccination, confirming its safety. In mouse, sow and piglet models, S1–F-VLP vaccination induced high levels of PEDV-specific antibodies including serum IgG, IgA (IgA) and neutralizing antibodies (NAbs). The piglet challenge test results showed that, compared with the control group, S1–F-VLP-vaccinated piglets had significantly lower diarrhea score and intestinal viral loads, and exhibited markedly reduced intestinal pathological damage. These results indicate that S1–F-VLP confers robust immune protection against the highly virulent PEDV strain and holds promise as a clinical candidate vaccine. Highlights • S1 conjugates with Ferritin via SpyTag-SpyCatcher to form VLPs. • S1 VLP vaccine induces PEDV-specific antibodies and robust immune responses. • S1 VLP vaccine is safe and highly effective, providing 100% protection in piglets. Keywords PEDV S1 Ferritin VLP Neutralizing antibodies pmc-status-qastatus 0 pmc-status-live yes pmc-status-embargo no pmc-status-released yes pmc-prop-open-access yes pmc-prop-olf no pmc-prop-manuscript no pmc-prop-legally-suppressed no pmc-prop-has-pdf yes pmc-prop-has-supplement no pmc-prop-pdf-only no pmc-prop-suppress-copyright no pmc-prop-is-real-version no pmc-prop-is-scanned-article no pmc-prop-preprint no pmc-prop-in-epmc yes pmc-license-ref CC BY-NC-ND 1 Introduction Porcine epidemic diarrhea (PED) is a highly contagious intestinal disease caused by infection with porcine epidemic diarrhea virus (PEDV). This disease has an acute onset and rapid progresses, accompanied by severe clinical symptoms such as diarrhea, vomiting and dehydration [ 1 ]. PEDV can infect pigs of all ages and causes nearly 100% mortality in suckling piglets, leading to significant economic losses in the swine industry. PEDV is an enveloped, single-stranded, positive-sense RNA virus belonging to the order Nidovirales, family Coronaviridae, and genus Alphacoronavirus. The PEDV genome is approximately 28 kb in size and contains a 5′ cap structure and a 3′ poly(A) tail. It encodes 16 non-structural proteins (nsp1 to nsp16) and four structural proteins-spike (S), envelope (E), membrane (M), and nucleocapsid (N)-as well as the accessory open reading frame 3 (ORF3) located between the S and E genes [ [2] , [3] , [4] ]. The S protein is a type I transmembrane spike glycoprotein located on the surface of the virion and consists of two subunits, S1 and S2. The S1 subunit is located at the N-terminal and contains multiple viral neutralizing epitopes and receptor-binding domains. Its primary function is to recognize and bind to the host cell receptor, as well as to mediate the induction of neutralizing antibodies. The S2 subunit, located at the C-terminus, forms the transmembrane domain of the S protein and is primarily responsible for mediating fusion between the viral envelope and the host cell membrane, facilitating the release of viral RNA into the host cell and leading to infection [ 5 ]. In addition, the N-terminal domain of the S protein and its glycosylation modifications play a crucial role in receptor binding and immune protection. The correct expression of the S protein and its proper glycosylation are major challenges in the development of recombinant subunit vaccines [ 5 , 6 ]. Therefore, based on the characteristics of the S protein as a target antigen, an in-depth analysis of the relationship between the high variability of PEDV, its genetic evolution, and functional implications is crucial for the development of effective PEDV vaccines. PEDV infection remains widespread globally and seriously affects sustainable development of the swine industry. Currently, vaccination is one of the primary strategies for controlling PEDV outbreaks. However, the vaccines currently used for the prevention and control of PEDV are primarily inactivated vaccines and attenuated live vaccines. While inactivated vaccines may suffer reduced immunogenicity due to the inactivation process, attenuated live vaccines, despite their high immunogenicity, carry a potential risk of reversion to virulence [ 7 ]. Therefore, developing a vaccine with high safety and strong immunogenicity is of critical importance. Subunit vaccines offer several advantages, including high safety, absence of infectious viral nucleic acids, potential for antigen redesign, and the ability to combine multiple antigens; furthermore, adjuvant incorporation can enhance vaccine efficacy [ 8 , 9 ]. Based on our understanding of coronavirus structure and function, particularly that of the novel coronavirus, we have conducted extensive basic research on the S protein of PEDV. Although the S protein forms a trimer through interactions mediated by the C-terminal sequence, it is the N-terminal S1 subunit that serves as the key antigenic region. The correct expression of S1 subunit and the subsequent formation of virus-like particles (VLPs) based on it may lead to enhanced immunogenicity. In this study, the SpyTag sequence was introduced at the C-terminus of the S1 protein. The protein was expressed using a eukaryotic expression system to obtain fully glycosylated S1. Subsequently, it was incubated in vitro with transferrin fused to the SpyCatcher sequence (SpyCatcher-Ferritin) to form virus-like particles displaying the S1 antigen, designated as S1–F-VLP. A novel subunit vaccine was prepared by emulsificatin with the ISA206 adjuvant (SEPPIC; adjuvant: aqueous phase = 1:1), and its immunogenicity and protective efficacy were subsequently evaluated through immunization studies in mice and piglets, respectively. 2 Materials and methods Cells and Viruses. Vero-CCL81 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) at 37°C under a humidified atmosphere of 5% CO 2 . HEK293 cells were cultured in Wayne 293 medium at 37°C, 125 rpm and a humidified atmosphere of 5% CO 2 . PEDV field isolates from China (strain JS/SJ-2022, GB: PP083729.1 ) were propagated in monolayers of Vero-CCL81 cells. Gene Synthesis and Plasmid Construction. A signal peptide was introduced at the N-terminus of the S1 sequence ( WRW24618.1 , 19-734 aa), while a linker, SpyTag sequence, and 6×His tag were added to the C-terminus. The codon-optimized gene was inserted into the pcDNA3.1 vector using Hin dIII and EcoRI restriction sites through chemical synthesis (pcDNA3.1-S1), and the recombinant expression vector was transformed into DH5α Escherichia coli to obtain bacterial clones. The target sequence, ferritin (UniProt: Q9ZLI1 ), was selected. A 6×His tag, an enterokinase cleavage site, a linker, and the SpyCatcher sequence were added to the N-terminus. The codon-optimized gene was inserted into the pET21a vector using NdeI and XhoI restriction sites through chemical synthesis (pET21a-SpyCatcher-Ferritin), and the recombinant expression vector was transformed into Escherichia coli BL21(DE3) to obtain the expression strain. Protein Expression and Puriffcation. The pcDNA3.1-S1 bacterial culture was inoculated into LB liquid medium supplemented with ampicillin sodium and incubated overnight in a shaking incubator at 250 rpm and 37°C. The plasmid was subsequently extracted. When the density of HEK293 cells reaches 1.3 × 10 6 to 1.7 × 10 6  cells/mL, transient transfection with the plasmid is performed. After a defined period of culture, the cell supernatant was collected for subsequent purification. The collected solution containing the target protein and imidazole was desalted into PBS buffer (pH 7.4) using G-25 dextran gel filtration resin. The BL21 expression strain harboring pET21a-SpyCatcher-Ferritin was inoculated into LB medium and cultured overnight in a shaking incubator at 37°C and 220 rpm. The above-mentioned bacterial suspension was inoculated into LB medium at a defined ratio for expansion culture. When the OD 600 reached 0.6 to 0.8, IPTG (final concentration: 1 mM) was added to induce protein expression for 6 to 8 h. Centrifuge to collect the bacterial pellet for ultrasonic disruption, followed by a second centrifugation to recover the supernatant for subsequent purification. The collected solution containing the target protein and imidazole was desalted into PBS buffer using G-25 dextran gel filtration resin. Assembly and Verification of S1 with SpyCatcher-Ferritin. SpyCatcher-Ferritin and S1 were prepared at a molar ratio of 1:2. After preparation, the mixture was inverted and mixed thoroughly, then incubated at 25°C for 6-8 h to allow assembly. The assembled S1–F-VLPs were subsequently analyzed by SEC-HPLC and SEM. Immune Assessment of BALB/c Mice and Piglets. Thirty 6-week-old BALB/c mice were selected and randomly assigned to three groups, with ten mice per group. Mice were immunized via intramuscular injection with PBS (pH 7.4), PEDV-S1 vaccine (25 μg), or PEDV-S1-F-VLP vaccine (25 μg) at weeks 0 and 2. Orbital blood was collected and serum was separated before primary immunization, after the first immunization, and after the second immunization. Mice were euthanized at week 6 for collection of serum and intestinal tissue samples for further analysis (with a subset sacrificed at week 4). Nine pregnant sows (35 days before delivery) were selected and randomly assigned to three groups, with three sows per group. All antigen and antibody test results for pregnant sows were negative for PEDV. Using the day of delivery as day 0, pregnant sows were immunized via intramuscular injection in the posterior neck region with PBS (pH 7.4), PEDV-S1 vaccine (100 μg), or PEDV-S1-F-VLP vaccine (100 μg) at −35 and −21 days relative to delivery. Blood samples were collected from the anterior vena cava and serum was separated before primary immunization, after the first immunization, and after the second immunization. On the day of delivery, colostrum was collected. All samples were stored at −20°C. Five 5-day-old piglets were randomly selected from each sow group for challenge. The piglets in the control group were orally administered PBS, whereas those in the immunization group received an oral challenge with the virulent PEDV-JS/SJ-2022 strain (10 6 TCID 50 /mL). Clinical symptoms in piglets were recorded daily over a 9-day consecutive period. Anorectal swabs were collected, and viral loads were quantified using real-time fluorescence quantitative PCR (RT-qPCR). PEDV-N gene-specific primers are listed in Table 1 . On day 9, piglets were euthanized, and serum and intestinal tissue samples were collected for detection of PEDV-specific IgG, IgA, and neutralizing antibody levels. Table 1 Sequences of primers used for qPCR. Table 1 Gene Forward (5′-3′) Reverse (5′-3′) PEDV-N CGGGTGCCATTATCTCTCTATG CGGGTGCCATTATCTCTCTATG GAPDH AAGGTGGTGAAGCAGGCGTC AGCTTGACGAAGTGGTCGTTGAG Enzyme-linked Immunosorbent Assay. To detect antibodies in the small intestinal tissues of mice or piglets, tissue samples require appropriate pre-processing. Jejunal tissues were homogenized in sterile centrifuge tubes containing an appropriate buffer solution, followed by centrifugation to obtain the supernatant for ELISA-based antibody detection. The titers of PEDV-specific IgG (ADANTI AD52415, China) and IgA (IDEXX 99-55550, USA) antibodies were determined using commercial ELISA kits according to the manufacturer's instructions. The absorbance at a wavelength of 450 nm was measured using a multifunction microplate reader (BIO-RAD, USA). Neutralization Assay. Serum and colostrum samples were inactivated at 56°C for 30 min. The samples were serially diluted two-fold and mixed with PEDV virus solution containing 200 TCID 50 /0.1 mL at 37°C for 1 h. The virus-sample mixture was inoculated into pre-cultured Vero-CCL81 cells and adsorbed for 1 h. The supernatant was removed, and the cells were washed twice with PBS. Subsequently, 200 μL of serum-free DMEM containing 3 μg/mL trypsin was added, and the cultures were maintained under continuous incubation. Cytopathic effects were observed and recorded. The neutralization titer was defined as the reciprocal of the highest serum dilution that completely suppressed PEDV infection. Histopathological Observation. Jejunal tissue samples from piglets were fixed in 4% paraformaldehyde for at least 24 h. The tissues were then removed and dehydrated sequentially through a graded alcohol series: 80%, 90%, 95%, and 100% ethanol. Subsequently, the samples were immersed in xylene, followed by paraffin infiltration and embedding. The embedded tissues were cooled, sectioned at 3 μm thickness, and prepared for HE staining. Finally, sections were mounted with neutral gum and examined under a light microscope. Statistical Analysis. Data were analyzed using one-way analysis of variance with SPSS 25.0 software; P  < 0.05 was considered statistically significant, and P  < 0.01 was considered highly significant. Results are expressed as mean ± standard error (Mean ± SE), and graphs were generated using GraphPad Prism version 8.0. 3 Results SpyTag-S1 Can Be Efficiently Conjugated to SpyCatcher-Ferritin. A signal peptide was introduced at the N-terminus of the PEDV-S1 protein, and a linker, SpyTag sequence, and 6×His tag were added at the C-terminus. The sequence was inserted into the pcDNA3.1 vector via Hin dIII and EcoRI digestion, yielding pcDNA3.1-S1 ( Fig. 1 A). Protein expression was performed using HEK293 cells as a eukaryotic expression system. S1 was then conjugated in vitro with SpyCatcher-ferritin to form virus-like particles displaying S1, designated S1–F-VLPs ( Fig. 1 B). SDS-PAGE results confirmed the successful expression of SpyTag-S1 and SpyCatcher-ferritin, and demonstrated an efficient covalent conjugation between SpyTag-S1 and SpyCatcher-ferritin. When the molar ratio of SpyCatcher-ferritin to SpyTag-S1 was 1:2, nearly all free S1 was consumed, indicating successful assembly between the two components ( Fig. 1 C). SEC-HPLC analysis showed that the elution time of S1-SpyCatcher-ferritin was earlier than that of SpyTag-S1, indicating that S1-SpyCatcher-ferritin had assembled into a high-molecular-weight complex ( Fig. 1 D). SEM analysis revealed that following successful conjugation of SpyTag-S1 and SpyCatcher-ferritin, numerous uniformly distributed spherical particles were observed under the microscope, indicating effective self-assembly into high-molecular-weight virus-like particles. Fig. 1 Antigen Design, Expression and Validation. A The design and construction strategy of SpyTag-S1. B Schematic representation of S1-Ferritin virus-like particles. SpyCatcher-Ferritin and SpyTag-S1 spontaneously assemble into heteroconjugates, leading to the display of S1 antigens on the surface of the ferritin 24-mer nanoparticle. C SDS-PAGE verification of S1-Ferritin virus-like particles. D Detection of S1-Ferritin virus-like particles using SEC-HPLC. E SEM detection of S1-Ferritin virus-like particles. The S1–F-VLP Vaccine Induces PEDV-specific Antibodies in Mice. Three groups of mice were immunized with PBS, PEDV-S1 vaccine, or PEDV-S1-F-VLP vaccine at weeks 0 and 2. Orbital blood samples were collected on a weekly basis, and intestinal tissues were harvested at weeks 4 and 6. ( Fig. 2 A). The levels of PEDV-specific IgG and IgA antibodies were measured by ELISA. Two weeks after the initial immunization, both the S1 vaccine and the S1–F-VLP vaccine induced detectable levels of PEDV-specific IgG and IgA antibodies in mice. From weeks 2 to 4 after the second immunization, serum IgG and IgA antibody titers in mice were significantly increased; the S1–F-VLP vaccine group exhibited higher antibody titers than the S1 vaccine group ( Fig. 2 B–C). The serum neutralizing antibody results are shown in Fig. 2 D. Two weeks after the initial immunization, both the S1 vaccine and the S1–F-VLP vaccine induced neutralizing antibodies in mice to varying degrees. From weeks 2 to 4 after the second immunization, serum neutralizing antibody titers increased significantly. The neutralizing antibody titer in the S1–F-VLP vaccine group was significantly higher than that in the S1 vaccine group ( Fig. 2 D). From weeks 2 to 4 after the second immunization, PEDV-specific IgG and IgA antibody titers in mouse jejunal tissues increased significantly; the S1–F-VLP vaccine group exhibited higher antibody titer increases than the S1 vaccine group ( Fig. 2 E–F). These results indicate that the PEDV-S1 series of subunit vaccines can induce high levels of immunogenicity; the S1–F-VLP vaccine elicits a stronger immune response than the S1 vaccine. Fig. 2 Antibody Responses in Mouse Serum and Intestinal Tissues. A Schematic diagram of the mouse experiment protocol. B PEDV-specific IgG antibodies in serum measured by ELISA. C PEDV-specific IgA antibodies in serum measured by ELISA. D Neutralizing antibody titers in serum against live infectious PEDV. E PEDV-specific IgG antibodies in jejunum measured by ELISA. F PEDV-specific IgA antibodies in jejunum measured by ELISA. The data are presented as the mean ± SEM, (n = 10). Significant differences between the control and objective groups are indicated as ** p  < 0.01 and * p  < 0.05. The S1–F-VLP Vaccine Induces Robust Immune Responses in Sows. To further evaluate the immunological efficacy of the S1–F-VLP vaccine, we designed a clinical trial protocol involving sow immunization and piglet challenge ( Fig. 3 A). During the immunization period, no clinical signs such as anorexia, diarrhea, abortion, death, or local abscess at the injection site were observed in the sows. Both the S1 vaccine and the S1–F-VLP vaccine induced high levels of PEDV-specific IgG and IgA antibodies in sow serum ( Fig. 3 B–C) and milk ( Fig. 3 E–F). After booster immunization, serum IgG and IgA antibody titers were significantly increased; the S1–F-VLP vaccine group exhibited higher antibody titers than the S1 vaccine group ( Fig. 3 B–C). The S1 and S1–F-VLP vaccines induced high-titer neutralizing antibodies in sow serum ( Fig. 3 D) and milk ( Fig. 3 G). The S1–F-VLP vaccine induced significantly higher antibody titers than the S1 vaccine ( Fig. 3 D–G). These results indicate that the PEDV-S1 series of subunit vaccines can elicit robust immune responses in pregnant sows; the S1–F-VLP vaccine induces a stronger immune response than the S1 vaccine. Fig. 3 Antibody Responses in the Serum and Colostrum of Pregnant Sows. A Schematic representation of the experimental protocol for immunizing sows and challenging piglets. B PEDV-specific IgG antibodies in serum measured by ELISA. C PEDV-specific IgA antibodies in serum measured by ELISA. D Neutralizing antibody titers in serum against live infectious PEDV. E PEDV-specific IgG antibodies in colostrum measured by ELISA. F PEDV-specific IgA antibodies in colostrum measured by ELISA. G Neutralizing antibody titers in colostrum against live infectious PEDV. The data are presented as the mean ± SEM, (n = 3). Significant differences between the control and objective groups are indicated as ** p  < 0.01 and * p  < 0.05. S1–F-VLP Protected Piglets Against PEDV. Five 5-day-old piglets were randomly selected from each group for clinical evaluation. Both the S1 and S1–F-VLP vaccines induced high levels of PEDV-specific IgG and IgA antibodies in piglet serum ( Fig. 4 A–B) and jejunal tissues ( Fig. 4 D–E). They also induced high-titer neutralizing antibodies in piglet serum ( Fig. 4 C), with the neutralizing antibody titer of the S1–F-VLP vaccine reaching at least 1:256. Overall, antibody levels induced by the S1–F-VLP vaccine were significantly higher than those induced by the S1 vaccine. The viral load in piglet feces was assessed by RT-qPCR. During the PEDV challenge period, PEDV RNA was detected in all rectal swabs collected from the vaccinated groups, except in the blank control group, with peak levels observed at DPI 4. The viral loads in anal swabs from the S1 vaccine and S1–F-VLP vaccine groups were significantly lower than those in the PBS group ( Fig. 4 F). The viral load in anal swabs from the S1–F-VLP vaccine group was lower than that in the S1 vaccine group. Clinical symptoms in piglets were monitored and analyzed ( Fig. 5 A). Piglets in the PBS group developed watery diarrhea starting on the second day post-challenge, with progressive worsening and associated small intestinal edema, intestinal wall thinning and transparency, and hemorrhage ( Fig. 5 A, indicated by arrows). On the fourth day post-challenge, both the S1 and S1–F-VLP vaccine groups exhibited mild diarrhea, which persisted for two days. Thereafter, feces became formed, mental status improved, and diarrhea resolved completely. Histopathological evaluation of jejunal structural integrity is shown in Fig. 5 B. The blank control group exhibited intact jejunal mucosa and villi, with structurally complete and uniformly arranged mucosal epithelial cells. The S1 and S1–F-VLP vaccine groups exhibited structurally intact jejunal mucosa, muscularis, and serosa layers with clear boundaries, and the intestinal villi were also morphologically preserved. In the PBS group, shedding of the cells at the tips of the jejunal mucosal villi was observed, and the lamina propria at the villus tips exhibited necrosis with homogeneous eosinophilic staining (black arrow). The above results indicate that the S1–F-VLP vaccine provides effective protection against PEDV infection in piglets. Fig. 4 Antibody Responses in the Serum and Intestinal Tissues of Piglets. A PEDV-specific IgG antibodies in serum measured by ELISA. B PEDV-specific IgA antibodies in serum measured by ELISA. C Neutralizing antibody titers in serum against live infectious PEDV. D PEDV-specific IgG antibodies in jejunum measured by ELISA. E PEDV-specific IgA antibodies in jejunum measured by ELISA. F Viral load in piglet feces. The data are presented as the mean ± SEM, (n = 5). Significant differences between the control and objective groups are indicated as ** p  < 0.01 and * p  < 0.05. Fig. 5 Clinical Symptoms and Histopathological Analysis of Piglets. A Observation of clinical diarrhea and anatomical findings in piglets. B Histopathological findings in the jejunum of piglets. 4 Discussion PEDV has long been present in the swine farming environment and is difficult to eradicate completely, having become one of the primary pathogens causing porcine viral diarrhea. Infection primarily affects the small intestine, accompanied by congestion and edema. The extensive replication of PEDV in intestinal epithelial cells leads to continuous cell necrosis, resulting in significant loss of absorptive enterocytes and impaired intestinal function, which in turn causes malabsorptive diarrhea and substantial economic losses to the global swine industry [ [10] , [11] , [12] , [13] ]. Currently, the vaccines used to control and prevent PEDV are primarily live attenuated or inactivated vaccines, which do not confer complete protective immunity in piglets. Therefore, there remains an urgent need to develop a novel and effective vaccine. In recent years, with advances in molecular biology techniques, research on PEDV vaccines has increasingly shifted toward genetically engineered vaccines. Among these, subunit vaccines are particularly favored due to their significant advantages, including safety, high efficacy, minimal side effects, and potential for industrial-scale production. As the most critical target antigen for PEDV subunit vaccines, the S protein represents a promising strategy for vaccine development [ 14 ]. Although the S protein forms a trimer via the C-terminal domain, the N-terminal S1 subunit constitutes the core epitope region where the RBD binds to the receptor protein [ 5 , 6 ]. Therefore, correct expression of the S1 protein is essential for achieving robust immunogenicity. In addition, transferrin can spontaneously assemble into a 24-mer structure, enabling surface display of the S1 protein and thereby effectively enhancing immunogenicity. Therefore, in this study, we employed SpyTag-SpyCatcher technology to conjugate PEDV-S1 with ferritin in vitro, and subsequently facilitated self-assembly into virus-like particles (VLPs). The aim is to develop a novel PEDV-S1-based VLP vaccine to address the current limitations of traditional vaccines, including suboptimal immune protection and the risk of reversion. The results demonstrate that the experimental design was highly successful. When the molar ratio of SpyCatcher-Ferritin to SpyTag-S1 is 1:2, nearly all free S1 is consumed, indicating an efficient covalent interaction between SpyTag-S1 and SpyCatcher-Ferritin. Scanning electron microscopy results revealed that SpyTag-S1 and SpyCatcher-Ferritin formed uniform spherical particles following successful conjugation. SEC-HPLC analysis further confirmed that SpyTag-S1 and SpyCatcher-Ferritin efficiently self-assembled into high-molecular-weight virus-like particles. Based on the excellent in vitro performance of S1-Ferritin-VLP, we evaluated its immunogenicity in a mouse model. S1 and S1–F-VLP were emulsified separately with the ISA 206 adjuvant (W/O/W) to prepare the final vaccines for mouse immunization. The results indicated that all PEDV-S1 series subunit vaccines induced high-titer IgG, IgA, and neutralizing antibodies specific to PEDV in mice, with the S1–F-VLP vaccine eliciting significantly higher antibody titers. The protective efficacy of the S1–F-VLP subunit vaccine was further validated using an experimental protocol that involved sow immunization followed by piglet challenge. During the immunization period, the sows exhibited no clinical signs, including anorexia, diarrhea, abortion, death, or local abscesses at the injection site, indicating that the vaccine is safe. The results of antibody detection in sow serum and colostrum demonstrated that both the S1–F-VLP and S1 vaccines induced high-titer neutralizing antibody production. Five-day-old piglets were orally inoculated with the highly virulent PEDV-JS/SJ-2022 strain at a dose of 10 6 TCID 50 /mL. Piglets in both the S1–F-VLP and S1 vaccine groups were effectively protected, exhibiting only mild diarrhea and rapid recovery to normal health. Histopathological examination of jejunum tissue sections from piglets further confirmed the above conclusion. Combined with the neutralizing antibody results, the S1–F-VLP vaccine induces higher levels of antibodies in piglets and provides enhanced protection against PEDV infection. In summary, we optimized the amino acid sequences of the PEDV-S1 and ferritin proteins, performed antigen recombination using SpyTag-SpyCatcher technology, and assembled them into an optimized recombinant vector, thereby successfully obtaining SpyTag-S1 and SpyCatcher-Ferritin proteins. The results of HPLC and SEM analyses both confirmed that the two components were successfully assembled into nanoparticles. Clinical trial results have demonstrated that the vaccine formulated by combining S1–F-VLP with the ISA206 adjuvant induces high-titer neutralizing antibodies, effectively protecting piglets against PEDV infection. The above results demonstrate that the S1–F-VLP recombinant subunit vaccine exhibits strong safety, high immunogenicity, and a high protection rate, indicating its potential as a candidate vaccine against PEDV. These findings also provide a foundation for the clinical application of other subunit vaccine development. Ethics statement The animal studies were approved by the Animal Ethics Committee of Jinyu Baoling Bio-pharmaceutical Company Limited (JYBLAEC-2025-059), and all animal procedures were performed in accordance with the Animal Ethics Procedures and Guidelines of the People's Republic of China. This study minimized animal suffering during sample collection. Notes The authors declare no competing financial interest. Funding Funding was provided by a grant ( 2022YFD1801800 ) from 10.13039/501100012166 National Key Research and Development Program of China (Youth Scientist Project)‌. The funder had no role in the design of the collection, analysis, and interpretation of data. CRediT authorship contribution statement Zhiqiang Li: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Writing – original draft, Writing – review & editing. Jie Li: Supervision, Writing – review & editing. Jiahai Cheng: Supervision, Validation, Writing – review & editing. Guigang Zhang: Supervision, Writing – review & editing. Mingzhi Zhao: Conceptualization, Formal analysis, Project administration, Resources, Supervision, Validation. Zhen Wang: Supervision, Writing – review & editing. Declaration of competing interest All authors disclosed no relevant relationships. References 1 Song D. Park B. Porcine epidemic diarrhoea virus: a comprehensive review of molecular epidemiology, diagnosis, and vaccines Virus Genes 44 2012 167 175 22270324 10.1007/s11262-012-0713-1 PMC7089188 2 Kocherhans R. Bridgen A. Ackermann M. Tobler K. Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence Virus Genes 23 2001 137 144 11724265 10.1023/A:1011831902219 PMC7089135 3 Si F. Song S. Yu R. Li Z. Wei W. Wu C. Coronavirus accessory protein ORF3 biology and its contribution to viral behavior and pathogenesis iScience 26 2023 106280 10.1016/j.isci.2023.106280 PMC9972675 36945252 4 Zhai X. Kong N. Zhang Y. Song Y. Qin W. Yang X. Ye C. Ye M. Tong W. Liu C. Zheng H. Yu H. Zhang W. Yang X. Zhang G. Tong G. Shan T. N protein of PEDV plays chess game with host proteins by selective autophagy Autophagy 19 2023 2338 2352 36861818 10.1080/15548627.2023.2181615 PMC10351448 5 Lin F. Zhang H. Li L. Yang Y. Zou X. Chen J. Tang X. PEDV: insights and advances into types, function, structure, and receptor recognition Viruses 14 8 2022 1744 36016366 10.3390/v14081744 PMC9416423 6 Huang C.Y. Draczkowski P. Wang Y.S. Chang C.Y. Chien Y.C. Cheng Y.H. Wu Y.M. Wang C.H. Chang Y.C. Chang Y.C. Yang T.J. Tsai Y.X. Khoo K.H. Chang H.W. Hsu S.D. In situ structure and dynamics of an alphacoronavirus spike protein by cryo-ET and cryo-EM Nat. Commun. 13 1 2022 4877 35986008 10.1038/s41467-022-32588-3 PMC9388967 7 Li Z. Ma Z. Li Y. Gao S. Xiao S. Porcine epidemic diarrhea virus: molecular mechanisms of attenuation and vaccines Microb. Pathog. 149 2020 104553 10.1016/j.micpath.2020.104553 PMC7527827 33011361 8 Du L. Tai W. Zhou Y. Jiang S. Vaccines for the prevention against the threat of MERS-CoV Expert Rev. Vaccine 15 2016 1123 1134 10.1586/14760584.2016.1167603 PMC5097835 26985862 9 Guo W. Wang C. Song X. Xu H. Zhao S. Gu J. Zou Z. Li J. Qian J. Zhang X. Guo R. Li J. Li L. Hu Z. Ren L. Fan B. Li B. Immunogenicity and protective efficacy of a trimeric full-length S protein subunit vaccine for porcine epidemic diarrhea virus Vaccine 42 4 2024 828 839 38220489 10.1016/j.vaccine.2024.01.020 10 Beam A. Goede D. Fox A. McCool M.J. Wall G. Haley C. Morrison R. A porcine epidemic diarrhea virus outbreak in one geographic region of the United States: descriptive epidemiology and investigation of the possibility of airborne virus spread PLoS One 10 12 2015 e0144818 10.1371/journal.pone.0144818 PMC4692406 26709512 11 Li Y. Wu Q. Huang L. Yuan C. Wang J. Yang Q. An alternative pathway of enteric PEDV dissemination from nasal cavity to intestinal mucosa in swine Nat. Commun. 9 1 2018 3811 30232333 10.1038/s41467-018-06056-w PMC6145876 12 Sun R.Q. Cai R.J. Chen Y.Q. Liang P.S. Chen D.K. Song C.X. Outbreak of porcine epidemic diarrhea in suckling piglets, China Emerg. Infect. Dis. 18 1 2012 161 163 22261231 10.3201/eid1801.111259 PMC3381683 13 Gallien S. Moro A. Lediguerher G. Catinot V. Paboeuf F. Bigault L. Berri M. Gauger P.C. Pozzi N. Authié E. Rose N. Grasland B. Evidence of porcine epidemic diarrhea virus (PEDV) shedding in semen from infected specific pathogen-free boars Vet. Res. 49 1 2018 7 29368629 10.1186/s13567-018-0505-2 PMC5784731 14 Li M. Sun X. Chen Y. Wang S. Li Q. Wang Y. Wang Y. Li R. Ding P. Zhang G. Enhancing humoral and mucosal immune response of PED vaccine candidate by fusing S1 protein to nanoparticle multimerization Vet. Microbiol. 290 2024 110003 10.1016/j.vetmic.2024.110003 38262114 Abbreviations used PEDV, Porcine epidemic diarrhea virus; TCID 50 , 50% tissue culture infective dose; VLP, Virus-Like Particles; S, Spike; S1–F-VLP, Spike 1-Ferritin-Virus-Like Particles; IgG, Immunoglobulin G; IgA, Immunoglobulin A; Nabs, Neutralizing antibodies. Data availability Data will be made available on request.