Virology 565 (2022) 58–64 Available online 2 November 2021
0042-6822/© 2021 Elsevier Inc. All rights reserved.
LDH nanoparticle adjuvant subunit vaccine induces an effective immune response for porcine epidemic diarrhea virus
Danyi Shi a,b,d,1, Baochao Fan a,g,1, Bing Sun c,1, Jinzhu Zhou a,d,e, Yongxiang Zhao a,d,
Rongli Guo a,d, Zengjun Ma b, Tao Song b, Huiying Fan h, Jizong Li a, Li Li a, Bin Li a,d,e,f,* a Institute of Veterinary Medicine, Jiangsu Academy of Agricultural Sciences, Key Laboratory of Veterinary Biological Engineering and Technology, Ministry of
Agriculture, Jiangsu Key Laboratory for Food Quality and Safety-State Key Laboratory Cultivation Base of Ministry of Science and Technology, Nanjing, 210014,
Jiangsu, China b College of Animal Science and Technology, Hebei Normal University of Science and Technology, Qinhuangdao, China c Australian Institute for Bioengineering and Nanotechnology, University of Queensland, St Lucia, QLD, 4072, Australia d Jiangsu Co-Innovation Center for the Prevention and Control of Important Animal Infectious Disease and Zoonose, Jiangsu Key Laboratory of Zoonosis, Yangzhou
University, Yangzhou, 225009, PR China e School of Food and Biological Engineering, Jiangsu University, Zhenjiang, 212013, China f 5College of Veterinary Medicine, Nanjing Agricultural University, No.1 Wei-gang, Nanjing, 210095, China g School of Life Sciences, Jiangsu University, Zhenjiang, 212013, China h College of Veterinary Medicine, South China Agricultural University, Guangzhou, 510642, China
A R T I C L E I N F O Keywords:
Spike gene Subunit vaccines LDH nanoparticle Adjuvant
PEDV A B S T R A C T Porcine Epidemic Diarrhea (PED) is a highly contagious intestinal disease which mostly caused by Porcine
Epidemic Diarrhea Virus (PEDV). The PED has caused huge economic losses to the pig industry all over the world and a valid PEDV vaccine is needed to prevent the infection. In this study, we constructed expression plasmid based on the spike (S) gene of the epidemic PEDV strain. The recombinant eukaryotic S (Se) and prokaryotic S (Sp) subunit proteins were expressed and purified as vaccine antigens. We designed a new subunit vaccine based on S proteins, adjuvanted with layered double hydroxide (LDH). The results indicated that the LDH adjuvanted subunit vaccines induced a better immune effect in terms of antibody level and cellular immune response. In conclusion, this study showed a new design of a PEDV subunit vaccine with nanotechnology and demonstrated the potential for its clinical application.
1. Introduction Porcine Epidemic Diarrhea Virus (PEDV) is a virus with envelope, single-stranded, positive-stranded RNA, belonging to the genus of alpha- coronavirus of the order Nidovirales (Coronaviridae) (Drexler et al.,
2010; Lecomte et al., 1987). It is an enveloped virus with a 28 kb genome that encodes four structural proteins: spike (S), envelope (E), membrane (M), and nucleocapsid (N) (Yang et al., 2014). Porcine
Epidemic Diarrhea (PED), caused by PEDV, is a highly contagious in testinal disease characterized by severe watery Diarrhea, vomiting and dehydration, as well as general symptoms such as vomiting, fever, anorexia, and lethargy. For suckling pigs, it is more sensitive to dehy dration and presents more severe clinical symptoms (Trujillo-Ortega et al., 2016; Gerber et al., 2016; Madson et al., 2014). PEDV was first reported in Belgium in 1971 and the United Kingdom in 1978 and then appeared in other European countries in the following years (Pensaert and de Bouck, 1978). PEDV can infect pigs of all ages and causes nearly
100% mortality in newborn piglets while mainly causes slow growth in adult pigs. In December 2010, a new highly virulent strain of PEDV spread rapidly in China, killing more than a million piglets and caused a miserable loss to the pig industry in a short time (Li et al., 2012; Zhang et al., 2019; Stevenson et al., 2013).
PEDV s protein is the main target of neutralizing anti-PEDV antibody and plays an important role in virus attachment, receptor binding and virus entry (Li et al., 2016). The S protein has neutralizing antibody induced epitopes and multiple B cell epitopes. Therefore, S protein is an important target protein in the vaccine design. In meantime, the adju vant is a critical component in vaccine formulation (Pollard and Bijker,
* Corresponding author. Institute of Veterinary Medicine, Jiangsu Academy of Agricultural Sciences, 50 Zhong-ling Street, Nanjing, 210014, China.
E-mail address: libinana@126.com (B. Li).
1 Contributing equally to the research.
Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/virology https://doi.org/10.1016/j.virol.2021.10.010
Received 25 August 2021; Received in revised form 5 October 2021; Accepted 28 October 2021
Virology 565 (2022) 58–64 59 2021). Mineral salt materials are the most widely used adjuvant for vaccines, and the most widely used type is aluminium salts that firstly reported by Alexander Glenny in 1926 (Chauhan et al., 2017; Glenny et al., 1926). However, the immune protection quality inconsistencies were frequently observed between batches of the same vaccine adju vanted by traditional aluminium hydroxide formula. The main reason was found to be the variation of aluminium hydroxide structure and the related physicochemical properties caused by very slight differences in the production (Kreuter, 1995). The aluminium-based layered double hydroxide (LDH) nanoparticles (NPs) have been proven to be a better adjuvant alternative to the aluminium hydroxide (Chen et al., 2018).
The nano-sized LDH was demonstrated better cellular internalization and the uniformed and reproducible LDH could maintain the quality of vaccines.
In this study, we prepared and characterized the recombinant PEDV
S protein by both eukaryotic and prokaryotic expression system and compared their immunogenicity in vivo. The recombinant eukaryotic S protein (Se) contains the NTD, COE, and several linear neutralizing epitopes. These parts were optimized and encoded tandemly with swine
Fc fragment of IgG to construct eukaryotic expression plasmid. Mean while, the recombinant prokaryotic S protein (Sp) containing the same
COE region. Meanwhile, we applied LDH nano-adjuvant in our vaccine formulations and compared it with the “gold standard” Freund’s adju vant (FA). We evaluated the immune responses of 6-week-old BALB/C mice induced by phosphate-buffered saline (PBS), Sp-LDH, Sp-FA, Se- LDH, or Se-FA. The in vivo immunization results show that the PEDV subunit vaccines adjuvanted by FA were superior in stimulating anti body response compared to LDH. However, the LDH nano-adjuvant can induce a generally comparable immune response to FA. Especially, the
Se-LDH vaccine was better than Se-FA vaccine for the promotion of cellular immunity. In conclusion, the combination of eukaryotic expressed subunit and LDH nano-adjuvant is a promising formula for future porcine vaccine design.
2. Materials and methods 2.1. Cells, bacterial and plasmids
The 293T cells, pcDNA3.1 and pGEX-4T-1 plasmid were kept in our lab. The plasmid transformed bacterial was prepared by Nanjing Gen
Script Biotechnology Co., Ltd. according to the designed PEDV eukary otic expression plasmid sequence. The prokaryotic expressed recombinant S protein was purified by AxyPrep Plasmid Miniprep Kit (Axygen Biosciences, Zhejiang, China).
2.2. Purification and characterization of eukaryotic expressed S protein
Expi293FTMcells were seeded at a concentration of 6 × 107 cells/ bottle into Expi293™ Expression Medium. The plasmid pcDNA3.1- PEDV was transfected with ExpiFectamine™ 293 Transfection Kit (Gibco, USA). The protein was collected at 48 h after transfection and purified using a HIS Trap FF crude Column (GE, USA). For Western Blot analysis, and cell lysates were separated by 10% SDS-PAGE (Absin,
Shanghai, China) and transferred to a nitrocellulose membrane. The membrane was blocked with 5% fat-free milk in phosphate-buffered saline (PBS) and incubated with HRP- conjugated Mouse anti-His-Tag mAb (ABclonal, USA) and, subsequently, with HRP-conjugated goat anti-mouse IgG (Sigma), followed by visualizing with diaminobenzidine (DAB) substrate (BOSTER, Wuhan, China).
2.3. PCR amplification and sequencing of PEDV-COE and 4T-1 genes
Primers (Table 1) were designed for amplifying PEDV-COE and 4T-1 based on the designed pcDNA3.1-PEDV gene sequence and the pub lished gene sequence of the vector pGEX-4T-1 gene (GenBank accession number NM U13853.1). All of the primers were synthesized by Gen
Script, Nanjing, China. PCR reactions for amplifying PEDV-COE and 4T- 1 with Taq DNA polymerase (TAKARA, Dalian, China) were run in a PCR thermal cycler (TAKARA, Dalian, China) with the following program: denaturation at 95 ◦C for 5 min, 30 cycles of denaturation at 95 ◦C for
15s, annealing at 57 ◦C for 30 s(vector pGEX-4T-1 57 ◦C for 5 min), and extension at 72 ◦C for 30s and ended with a final extension of 7 min at
72 ◦C.
2.4. Purification and characterization of prokaryotic expressed S protein
The PCR product was cloned into the prokaryotic expression vector
4T-1 using 2 × ClonExpress Mix (Vazyme, Nanjing, China). The ligated product was initially propagated in competent Escherichia coli cells (Takara, Dalian, China). The transformed colonies were screened by
DNA sequencing (GenScript, Nanjing, China). The recombinant 4T- PEDV plasmid was extracted and purified from the E. coli cells, and used to transform E. coli BL21 (DE3) cells (Takara, Dalian, China) for 4T- PEDV expression. 4T-PEDV expression was induced by the addition of 1 mM isopropy1-β-D-1-thiogalactopyranoside (IPTG) (Zhuyan, Nanjing,
China) to the transformed BL21 (DE3) bacteria when they reached an optical density at 600 nm (OD600) of 0.6 at 37 ◦C. The samples were collected after 6 h and analyzed by sodium dodecyl sulfate poly acrylamide gel electrophoresis (SDS-PAGE). The 4T-PEDV proteins were purified using GSTSep Glutathione 4FF Chromatography column (YEASEN, Shanghai, China) as per the manufacturer s instructions.
2.5. Preparation and characterization of LDH nanoparticles
Solution A contains 15 mL of Mg(NO3)2 (8.0 mmol), and Al(NO3)3 (4.0 mmol) and solution B contains 20 mL of 4.0 M NaOH solution with adding 20 mmol of lactic acid (88%) were prepared. And 15 mL of so lution A was added into 11 mL of solution B under vigorous stirring for 2 h. After the reaction, the precipitate was ultra-sonicated in an ice bath for 10 min. The pure LDH slurry was obtained via centrifuge at 5000 rpm for 10 min and washed twice with water and then dispersed in 20 mL of water. The particle size of LDH adjuvant was measured by Nanometer particle size and potential analyzer (NICOMP 380 Z3000) (PSS, USA).
2.6. Immunization schedule Thirty of six-week-old BALB/c mice were purchased from Yang Zhou
University. The mice were randomly divided into six groups before the start of the experiment. The PEDV Sp and Se subunit were mixed with
100 μg LDH or FA (detail, source). The immunization dose and schedule are shown in Table 2. The mice were immunized s.c. three times at 2- week intervals. Serum samples were collected at 14, 28, and 42 days post immunization (DPI) for serological tests. Six weeks after primary immunization, mice were sacrificed and splenocytes were isolated
Table 1 Primer sequences for amplification of porcine PEDV-COE and 4T-1.
Name Sequence Amplified gene PEDV-COE F GTTCCGCGTGGATCCCCGGAATTCACAAGCTTCGTGACCCTGCCCTCTTT
PEDV-COE PEDV-COE R CAGTCACGATGCGGCCGCTCGAGCACTCCCTCCAGAGGCTTGGGTGTGC
4T-1 F CTCGAGCGGCCGCATCGTGACTGACTGACGATCTG 4T-1 4T-1 R
GAATTCCGGGGATCCACGCGGAACCAGATCCGATT D. Shi et al.
Virology 565 (2022) 58–64 60 (Wang et al., 2007; Xiao et al., 2004) for lymphocyte subtype ratio detection, lymphocyte proliferation assays and Mouse cytokine detection.
2.7. Serological tests The purified 4T-PEDV recombinant protein was used as coating an tigen for the endpoint ELISA to determine the IgG-specific antibodies.
Serum neutralization assays were performed with a method described by
Ostrowski et al. (2002) with some modifications. Briefly, the collected sera samples were heat-inactivated for 30 min at 56 ◦C and serially diluted in twofold. Then the diluted samples were mixed with an equal volume of PEDV strain AH2012/12 containing 100 × TCID50 and incubated at 37 ◦C for 1 h. Subsequently, 0.1 mL of each mixture was transferred to Vero cell monolayers in a 96-well tissue culture plate and washed once with Dulbecco’s modified eagle medium (DMEM) (Gibco,
USA). After adsorption for 1.5 h at 37 ◦C, the inocula were discarded, and the cells were washed twice with DMEM. Next, the maintenance medium containing trypsin (5 μg/mL) was added to each well, and the plate was incubated for 24h at 37 ◦C. Cells were examined daily for cytopathic effects (CPE). The neutralization titers were expressed as the reciprocal of the highest serum dilution resulting in a complete neutralization. Each sample was run in two copies.
2.8. Analysis of CD3+CD4+ and CD3+CD8+ splenocytes
At 42 DPI, mice were sacrificed and splenocytes were isolated, and transferred into a 1.5 mL centrifuge tube (1 × 106 cells) and washed once with PBS. The pellet was resuspended in 300 μL of cell fluorescence solution for staining with APC anti-mouse CD3 (BioLegend, USA), FITC rat anti-mouse CD4 (L3T4) (BioLegend, USA) and PE Rat anti-mouse
CD8a (BioLegend, USA) fluorescent antibodies at 4 ◦C in the dark for
30 min, the tube was centrifuged at 1500 rpm for 5 min, the supernatant was removed, and washed twice with PBS. The cell pellet was resus pended in 500 μL of fluorescence preservation solution (0.15 M PBS pH
7.4, 2% glucose, 1% formaldehyde, 0.1%NaN3). Flow cytometry (AccuriTM C6 Plus, BD, USA) was then used to count CD3+CD4+ and
CD3+CD8+ T-cells in 10,000 cells, and percentages of CD3+CD4+ and
CD3+CD8+ T-cells were determined.
2.9. Lymphocytes proliferation assay Splenocytes were seeded at 2 × 105 cells/well in 96-well plates and stimulated with 10 μg/mL of ConA (Sigma). Each sample included three repetition wells. The 96-well cell culture plate was incubated in a 5%
CO2 incubator at 37 ◦C for about 72 h, and the supernatant of cell culture media was collected for cytokine detection and replaced with fresh media. And then 20 μL (5 mg/mL) Tetrazolium bromide (MTT) (Zhuyan,
Nanjing, China) solution was added to each well, before incubating for
4h in a 5% CO2 incubator at 37 ◦C (aspirate the supernatant for cytokine detection). Then 150 μL of DMSO (Zhuyan, Nanjing, China) was added to each well, and an ELISA microplate reader measured the absorbance at 490 nm. The relative appreciation rate (P%) was calculated as the ratio of the average OD value of antigen-stimulated wells to that of unstimulated wells multiplied by 100%.
2.10. Cytokine detection The supernatant collected in the previous experiment were used for cytokine detection. The concentrations of IFN-γ and IL-4 in the super natant of spleen lymphocytes were detected by IFN-γ enzyme-linked immunoassay kit (MEIMIAN, Jiangsu, China) and IL-4 enzyme-linked immunoassay kit (MEIMIAN, Jiangsu, China) as per the manufacturer’s instructions.
2.11. Statistical analysis Statistical analysis was performed using GraphPad Prism version 5 (GraphPad Software, San Diego, CA, USA). Statistical analyses were performed by one-way analysis of variance, followed by Tukey’s HSD test and student’s t-test. P < 0.05 represents a statistically significant difference. All data are expressed as the mean ± standard error of mean (S.E.M.).
3. Results 3.1. Eukaryotic S proteins purification and verification
The PEDV eukaryotic expression plasmid sequences we designed included the signal peptide of IL2S, the sialic acid-binding region (NTD), the neutralizing antigen core region (COE) and multiple B cell recog nition epitopes in the S2 subunit linked by flexible Linker and finally tandem with the swine Fc fragment (Fig. 1). As shown in Fig. 2, a specific protein band of 75 kDa, consistent with the expected molecular sizes, could be detected by Western blot in purified protein from pcDNA3.1- PEDV transfected cells.
3.2. Prokaryotic protein purification and verification
Single PCR products of the PEDV-COE (421 bp) and 4T-1 (4960 bp) were amplified using the plasmids of pcDNA3.1-PEDV or pGEX-4T-1, which were constructed and kept in our laboratory. The plasmid of
4T-PEDV was successfully constructed and the sequencing of PEDV-COE was performed.
As shown in Fig. 3, the purified 4T-PEDV protein was analyzed by
Western blotting. The specific protein band of 44 kDa is consistent with the expected molecular weight of 4T-PEDV S protein, which was observed in purified protein.
3.3. LDH adjuvant particle size determination The average particle size of LDH is 140.2 nm (Fig. 4), and the
Polydispersity Index (PdI) = 0.143 indicates that the NPs are uniformly dispersed. The size and PdI of our synthesized LDH NPs were consistent with the reported (Chen et al., 2018) and can be used as an adjuvant.
3.4. The humoral immune response after immunization
The mice were immunized at days 0, 14, and 28 and serum samples collected at 14, 28, and 42 day post immunization (DPI) were used to detect IgG-specific antibody by ELISA using purified 4T-PEDV protein as
Table 2 Immunization plan for animal experiments.
Group Immunogen Immunogen amount per mouse Adjuvant
Immunization dosag per mouse Immune pathway GX No operation
G1 4T-PEDV 20 μg LDH 100 μL Subcutaneous injection
G2 4T-PEDV 20 μg Freund’s adjuvant 100 μL G3 pcDNA3.1-PEDV
20 μg LDH 100 μL G4 pcDNA3.1-PEDV 20 μg Freund’s adjuvant
100 μL G5 PBS – – 100 μL D. Shi et al.
Virology 565 (2022) 58–64 61 the antigen. As shown in Fig. 5A, at 28 and 42 DPI, the IgG antibody titer in the group injected with Sp-FA was highest and followed by Sp-LDH group, both of which were significantly higher than the group inocu lated with PBS.
The neutralization capacity of each serum sample was also evaluated in vitro by serum neutralization assays (Fig. 5B). At 42 DPI, the PEDV- specific neutralizing antibody titers were 1:12, 1:47, 1:30 and 1:64 of mice injected with Sp-LDH, Sp-FA, Se-LDH, or Se-FA, respectively.
Among them, the FA adjuvanted groups had higher neutralizing anti body titers than LDH adjuvanted groups.
3.5. Analysis of CD3+CD4+ and CD3+CD8+ T-cells Lymphocytes were isolated at 42 DPI and analyzed for CD3+CD4+ and CD3+CD8+ T-cells by flow cytometry. As shown in Fig. 6A, the percentages of CD3+CD4+ T-cells in the Sp-FA and Se-LDH groups were significantly higher than the PBS control group (P < 0.001). Similarly, the percentages of CD3+CD8+ T-cells (Fig. 6B) in the Sp-FA and Se-LDH groups were significantly higher than the PBS control group (P < 0.05).
3.6. The lymphocytes proliferation At 42 DPI, splenocytes were isolated and restimulated in vitro with
ConA (10 μg/mL) to analyze cellular immune responses. As shown in
Fig. 7A, the Sp-FA, Se-LDH and Se-FA vaccines elicited significantly enhanced lymphocyte proliferative responses than PBS (P < 0.05).
3.7. The cytokine produce after immunization To further characterize the cellular immune responses in immunized mice, the IFN-γ and IL-4 secretion in splenocytes restimulated with ConA was measured by ELISA. As shown in Fig. 7B, the mean IFN-γ pro ductions were 692.18 ng/L and 645.27 ng/L in mice immunized with Sp- FA and Se-LDH, which were both significantly higher (P < 0.01) than that in mice immunized with PBS (342.59 ng/L). Meanwhile, the mean
IL-4 productions were 226.6 pg/mL, 203.3 pg/mL and 207.42 pg/mL in mice immunized with Sp-FA, Se-LDH, and Se-FA (Fig. 7C), which were significantly higher (P < 0.001) than that in mice immunized with PBS (101.8 pg/mL).
4. Discussion PED is a viral disease causing catastrophic economic losses in the pig industry worldwide. The development of a safe and efficient vaccine is of great significance to prevent and control PEDV as the existing vaccines could not provide valid protection. It has been reported that PEDV’s protein is the main target of neutralizing anti-PEDV antibody because S protein shows a pivotal function in regulating the interactions between virus and specific host cell receptor glycoproteins which further medi ates viral entry (Bosch et al., 2003). In addition, the assistant of adjuvant is critical in the immunization of subunit protein vaccines (Kreuter,
1995). Nanoparticles demonstrated great potential as adjuvant and recently became one of the research focus in viral vaccines (Azmi et al.,
2014). The aluminium-based LDH nanoparticles have shown low cyto toxicity and excellent biocompatibility (Sulczewski et al., 2018) and provided a controlled release of vaccine antigen. LDH can induce potent immune responses (A et al., 2006) and has been widely tested in various vaccines (Chen et al., 2016; Al et al., 2011).
The core neutralization antigen region of PEDV is the COE region, has been widely applied to develop PEDV subunit vaccines (Li et al.,
2020) and has a certain effect. Currently, the PEDV receptor is not clear,
Fig. 1. Structural diagram of PEDV eukaryotic (A) and prokaryotic (B) expression plasmid sequences. The complete sequences were cloned into the pcDNA3.1 and pGEX-4T vectors respectively.
Fig. 2. Western blotting analysis of eukaryotic expression of recombinant
PEDV-Se subunit. The PEDV-Se purified with HIS Trap FF crude Column (lanes
1–2) and protein standard (lane M).
D. Shi et al.
Virology 565 (2022) 58–64 62 but the NTD receptor region (sialic acid-binding domain) of the S protein represents a novel vaccine candidate molecule that has been confirmed (Kim et al., 2018). Therefore, in this study, the NTD region was con nected in series with the COE region, and further connected with the identified linear neutralizing epitope (Okda et al., 2017) to study its immune effect, and at the same time, the COE’s prokaryotic expression protein was used for comparison. In this study, the PEDV eukaryotic expression plasmid and the prokaryotic expression plasmid were con structed by transforming the RBD region of the PEDV S protein, and two recombinant S proteins were eukaryotic expressed (Se) or prokaryotic expressed (Sp) as subunit vaccines. Both PEDV Se and Sp subunits were mixed and emulsified with either Freund’s adjuvant (FA) or LDH adju vant to prepare Sp-LDH, Se-LDH, Sp-FA, and Se-FA vaccines. These 4 vaccines were injected subcutaneously to immunize 6-week-old BALB/c mice for three immunizations with 2 weeks interval. The results indi cated the IgG antibody titer in the groups injected with Sp-FA and
Sp-LDH were significantly higher than the group inoculated with PBS at both 28 and 42 DPI. More importantly, the PEDV specific neutralizing antibody titers were 1:12, 1:47, 1:30 and 1:64 of the groups injected with Sp-LDH, Sp-FA, Se-LDH, or Se-FA, respectively, at 42 DPI. Overall, the FA adjuvanted groups had higher neutralizing antibody titers than
Fig. 3. Western blotting analysis of prokaryotic expression of recombinant PEDV-Sp subunit. The cell lysis containing PEDV-Sp after induced expression (lanes 1).
The protein standard (lane M) and the filtered cell lysis containing PEDV-Sp (lane 2). The PEDV-Sp purified with GSTSep Glutathione 4FF Chromatography column (lanes 3–11).
Fig. 4. The average size, PdI, and size distribution of LDH nanoparticles.
Fig. 5. The humoral and cellular immune response in mice induced by different preparations. Serum samples were collected at 14, 28, 42 DPI to determine IgG- specific ELISA antibody (A) and PEDV neutralizing antibody titers at 42 DPI (B). Data are shown as mean ± S.E.M.
D. Shi et al.
Virology 565 (2022) 58–64 63 LDH adjuvanted groups. The coronavirus vaccine which induces neutralizing antibody titer higher than 24 in mice may provide a solid protective effect (Subbarao et al., 2004). In this study, the neutralizing antibody titer of groups immunized with Sp-FA, Se-LDH and Se-FA were greater than 24 which suggests these three PEDV subunit vaccines are valid candidates for clinical application.
Furthermore, we analyzed the cellular immune response in the terms of T-cells population, lymphocytes proliferation and cytokines produc tion. Compared with the group injected with PBS, each immunized group showed increase in both CD3+CD4+ and CD3+CD8+ T-cells pop ulation as well as the IFN-γ and IL-4 cytokines concentration to varying degrees. This observation indicated that these four subunit vaccines could improve the immune function of peripheral blood T-lymphocyte and the expression of cytokines. Among them, the Sp-FA vaccines demonstrated the highest potency to activate cellular immune and fol lowed by Se-LDH. We further performed the lymphocytes proliferation assay as it is important for monitoring cellular immune function (Gu et al., 2019). As a result, each Sp-FA, Se-LDH and Se-FA vaccine elicited significantly enhanced lymphocyte proliferative responses.
Moreover, the IL2s is the signal peptide with the function of increasing the expansion of antigen-specific T cells (Sultan et al., 2018).
The pig Fc fragment provides the ability of expressed subunits to interact with Fc gamma receptors (FcγRs) on innate immune cells (Pincetic et al.,
2014). Thereby, the IL2s and pig FC gene were integrated into PEDV-Se vaccine to enhance their immune protection in this study. As a result, the modified Se-LDH nano-vaccine induced both higher antigen-specific antibody and cellular immunity than Sp-LDH. This IL2s/Fc modifica tion could be applied in future subunit nano-vaccine design.
In summary, the PEDV subunit vaccine prepared with both the prokaryotic and eukaryotic express system showed great immunogenicity although prokaryotic S protein induced a slightly stronger immune response with FA. Generally, the LDH adjuvanted subunit vaccine provided a slightly weaker but comparable level of immunity to that of traditional FA, while LDH has a great advantage of safety for clinic application and the potential for further modification.
Interestingly, the LDH nanoparticles adjuvant demonstrated higher po tential to adjuvants eukaryotic recombinant subunit vaccine. Previous studies indicated that S protein-based subunit vaccines may not provide complete protection to suckling piglets from PEDV infection (Makadiya et al., 2016; Oh et al., 2014). Thus, it is the top priority to develop effective, safe, and low-cost adjuvants to enhance the immunogenicity of subunit vaccines for the pig industry. This study lays the foundation for the later preparation of subunit vaccines for clinical application, but further research is still needed.
CRediT authorship contribution statement Danyi Shi: took part in all the experiments and wrote the manu script. Baochao Fan: took part in all the experiments and wrote the manuscript. Bing Sun: took part in all the experiments and wrote the manuscript. Jinzhu Zhou: conducted RNA isolation, RT-PCR detection and sample processing for testing. Yongxiang Zhao: conducted RNA isolation, RT-PCR detection and sample processing for testing. Rongli
Guo: conducted RNA isolation, RT-PCR detection and sample processing for testing. Zengjun Ma: Formal analysis, conducted data analysis, BL contributed essential ideas and discussion. Tao Song: Formal analysis, conducted data analysis, BL contributed essential ideas and discussion,
All authors read and approved the final manuscript. Huiying Fan: helped to design the whole project and draft the manuscript. Jizong Li: helped to design the whole project and draft the manuscript. Li Li:
Fig. 6. Flow cytometric analysis of proportions of CD3+CD4+ (A) and CD3+CD8+ (B) T-cell subpopulations in splenocytes from different groups of mice at 42 DPI.
Results were obtained by averaging data from the five serum samples (n = 5) of each group. Data are shown as mean ± S.E.M.
Fig. 7. Cellular immune responses in mice inoculated with Sp-LDH, Sp-FA, Se-LDH, Se-FA or PBS. Splenocytes were isolated to determine lymphocyte proliferation rate (P%) (A), IFN-γ expression (B), and IL-4 expression (C). Data are shown as mean ± S.E.M.
D. Shi et al.
Virology 565 (2022) 58–64 64 helped to design the whole project and draft the manuscript. Bin Li: helped to design the whole project and draft the manuscript.
Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgements This work was supported by National Natural Science Foundation of
China (31872481, 32002283), Jiangsu province Natural Sciences
Foundation (BK20190003, BK20191235, BK20210158), Jiangsu Agri cultural Science and Technology Innovation Fund (CX (21) 3139), supported by the Natural Science Foundation of Guangdong Province (2019A1515010658).
References A, Z.P.X., B, Q.H.Z., A, G.Q.L., B, A.B.Y., 2006. Inorganic nanoparticles as carriers for efficient cellular delivery - ScienceDirect. Chem. Eng. Sci. 61, 1027–1040. https:// doi.org/10.1016/j.ces.2005.06.019.
Al, A., Lq, A., Ww, A., Rz, A., Yy, A., Hui, L.B., Sw, A., 2011. The use of layered double hydroxides as DNA vaccine delivery vector for enhancement of anti-melanoma immune response. Biomaterials 32, 469–477. https://doi.org/10.1016/j. biomaterials.2010.08.107.
Azmi, F., Ahmad Fuaad, A.A., Skwarczynski, M., Toth, I., 2014. Recent progress in adjuvant discovery for peptide-based subunit vaccines. Hum. Vaccines Immunother.
10, 778–796. https://doi.org/10.4161/hv.27332.
Bosch, B.J., van der Zee, R., de Haan, C.A., Rottier, P.J., 2003. The coronavirus spike protein is a class I virus fusion protein: structural and functional characterization of the fusion core complex. J. Virol. 77, 8801–8811. https://doi.org/10.1128/ jvi.77.16.8801-8811.2003.
Chauhan, N., Tiwari, S., Iype, T., Jain, U., 2017. An overview of adjuvants utilized in prophylactic vaccine formulation as immunomodulators. Expert Rev. Vaccines 16,
491–502. https://doi.org/10.1080/14760584.2017.1306440.
Chen, W., Bing, Z., Mahony, T., Gu, W., Zhi, P.X., 2016. Efficient and durable vaccine against intimin β of diarrheagenic E. Coli induced by clay nanoparticles. Small 12. https://doi.org/10.1002/smll.201670058, 1541-1541.
Chen, W., Zuo, H., Li, B., Duan, C., Rolfe, B., Zhang, B., Mahony, T.J., Xu, Z.P., 2018.
Clay nanoparticles elicit long-term immune responses by forming biodegradable depots for sustained antigen stimulation. Small 14, e1704465. https://doi.org/
10.1002/smll.201704465.
Drexler, J.F., Gloza-Rausch, F., Glende, J., Corman, V.M., Muth, D., Goettsche, M.,
Seebens, A., Niedrig, M., Pfefferle, S., Yordanov, S., Zhelyazkov, L., Hermanns, U.,
Vallo, P., Lukashev, A., Muller, M.A., Deng, H., Herrler, G., Drosten, C., 2010.
Genomic characterization of severe acute respiratory syndrome-related coronavirus in European bats and classification of coronaviruses based on partial RNA-dependent
RNA polymerase gene sequences. J. Virol. 84, 11336–11349. https://doi.org/
10.1128/JVI.00650-10.
Gerber, P.F., Lelli, D., Zhang, J., Strandbygaard, B., Moreno, A., Lavazza, A., Perulli, S.,
Botner, A., Comtet, L., Roche, M., Pourquier, P., Wang, C., Opriessnig, T., 2016.
Diagnostic evaluation of assays for detection of antibodies against porcine epidemic diarrhea virus (PEDV) in pigs exposed to different PEDV strains. Prev. Vet. Med. 135,
87–94. https://doi.org/10.1016/j.prevetmed.2016.11.005.
Glenny, A.T., Pope, C.G., Waddington, H., Wallace, U., 1926. Immunological notes.
XVII–XXIV. J. Pathol. Bacteriol. 29 https://doi.org/10.1002/path.1700290106.
Gu, P., Liu, Z., Sun, Y., Ou, N., Hu, Y., Liu, J., Wu, Y., Wang, D., 2019. Angelica sinensis polysaccharide encapsulated into PLGA nanoparticles as a vaccine delivery and adjuvant system for ovalbumin to promote immune responses. Int. J. Pharm. 554,
72–80. https://doi.org/10.1016/j.ijpharm.2018.11.008.
Kim, S.H., Cho, B.H., Lee, K.Y., Jang, Y.S., 2018. N-terminal domain of the spike protein of porcine epidemic diarrhea virus as a new candidate molecule for a mucosal vaccine. Immune Netw 18, e21. https://doi.org/10.4110/in.2018.18.e21.
Kreuter, J., 1995. Nanoparticles as adjuvants for vaccines. Pharmaceut. Biotechnol. 6,
463–472. https://doi.org/10.1007/978-1-4615-1823-5_19.
Lecomte, J., Cainelli-Gebara, V., Mercier, G., Mansour, S., Talbot, P.J., Lussier, G.,
Oth, D., 1987. Protection from mouse hepatitis virus type 3-induced acute disease by an anti-nucleoprotein monoclonal antibody. Brief report. Arch. Virol. 97, 123–130. https://doi.org/10.1007/BF01310740.
Li, W., Li, H., Liu, Y., Pan, Y., Deng, F., Song, Y., Tang, X., He, Q., 2012. New variants of porcine epidemic diarrhea virus, China, 2011. Emerg. Infect. Dis. 18, 1350–1353. https://doi.org/10.3201/eid1808.120002.
Li, W., van Kuppeveld, F.J.M., He, Q., Rottier, P.J.M., Bosch, B.J., 2016. Cellular entry of the porcine epidemic diarrhea virus. Virus Res. 226, 117–127. https://doi.org/
10.1016/j.virusres.2016.05.031.
Li, Z., Ma, Z., Li, Y., Gao, S., Xiao, S., 2020. Porcine epidemic diarrhea virus: molecular mechanisms of attenuation and vaccines. Microb. Pathog. 149, 104553. https://doi. org/10.1016/j.micpath.2020.104553 doi: 10.1016/j.micpath.2020.104553.
Madson, D.M., Magstadt, D.R., Arruda, P.H., Hoang, H., Sun, D., Bower, L.P.,
Bhandari, M., Burrough, E.R., Gauger, P.C., Pillatzki, A.E., Stevenson, G.W.,
Wilberts, B.L., Brodie, J., Harmon, K.M., Wang, C., Main, R.G., Zhang, J., Yoon, K.J.,
2014. Pathogenesis of porcine epidemic diarrhea virus isolate (US/Iowa/18984/
2013) in 3-week-old weaned pigs. Vet. Microbiol. 174, 60–68. https://doi.org/
10.1016/j.vetmic.2014.09.002.
Makadiya, N., Brownlie, R., van den Hurk, J., Berube, N., Allan, B., Gerdts, V.,
Zakhartchouk, A., 2016. S1 domain of the porcine epidemic diarrhea virus spike protein as a vaccine antigen. Virol. J. 13, 57. https://doi.org/10.1186/s12985-016- 0512-8.
Oh, J., Lee, K.W., Choi, H.W., Lee, C., 2014. Immunogenicity and protective efficacy of recombinant S1 domain of the porcine epidemic diarrhea virus spike protein. Arch.
Virol. 159, 2977–2987. https://doi.org/10.1007/s00705-014-2163-7.
Okda, F.A., Lawson, S., Singrey, A., Nelson, J., Hain, K.S., Joshi, L.R., Christopher- Hennings, J., Nelson, E.A., Diel, D.G., 2017. The S2 glycoprotein subunit of porcine epidemic diarrhea virus contains immunodominant neutralizing epitopes. Virology
509, 185–194. https://doi.org/10.1016/j.virol.2017.06.013.
Ostrowski, M., Galeota, J.A., Jar, A.M., Platt, K.B., Osorio, F.A., Lopez, O.J., 2002.
Identification of neutralizing and nonneutralizing epitopes in the porcine reproductive and respiratory syndrome virus GP5 ectodomain. J. Virol. 76,
4241–4250. https://doi.org/10.1128/jvi.76.9.4241-4250.2002.
Pensaert, M.B., de Bouck, P., 1978. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 58, 243–247. https://doi.org/10.1007/BF01317606.
Pincetic, A., Bournazos, S., DiLillo, D.J., Maamary, J., Wang, T.T., Dahan, R., Fiebiger, B.
M., Ravetch, J.V., 2014. Type I and type II Fc receptors regulate innate and adaptive immunity. Nat. Immunol. 15, 707–716. https://doi.org/10.1038/ni.2939.
Pollard, A.J., Bijker, E.M., 2021. A guide to vaccinology: from basic principles to new developments. Nat. Rev. Immunol. 21, 83–100. https://doi.org/10.1038/s41577- 020-00479-7.
Stevenson, G.W., Hoang, H., Schwartz, K.J., Burrough, E.R., Sun, D., Madson, D.,
Cooper, V.L., Pillatzki, A., Gauger, P., Schmitt, B.J., Koster, L.G., Killian, M.L.,
Yoon, K.J., 2013. Emergence of Porcine epidemic diarrhea virus in the United States: clinical signs, lesions, and viral genomic sequences. J. Vet. Diagn. Invest. 25,
649–654. https://doi.org/10.1177/1040638713501675.
Subbarao, K., McAuliffe, J., Vogel, L., Fahle, G., Fischer, S., Tatti, K., Packard, M.,
Shieh, W.J., Zaki, S., Murphy, B., 2004. Prior infection and passive transfer of neutralizing antibody prevent replication of severe acute respiratory syndrome coronavirus in the respiratory tract of mice. J. Virol. 78, 3572–3577. https://doi. org/10.1128/jvi.78.7.3572-3577.2004.
Sulczewski, F.B., Liszbinski, R.B., Romao, P.R.T., Rodrigues Junior, L.C., 2018.
Nanoparticle vaccines against viral infections. Arch. Virol. 163, 2313–2325. https:// doi.org/10.1007/s00705-018-3856-0.
Sultan, H., Kumai, T., Fesenkova, V.I., Fan, A.E., Wu, J., Cho, H.I., Kobayashi, H.,
Harabuchi, Y., Celis, E., 2018. Sustained persistence of IL2 signaling enhances the antitumor effect of peptide vaccines through T-cell expansion and preventing PD-1 inhibition. Cancer Immunol Res 6, 617–627. https://doi.org/10.1158/2326-6066.
CIR-17-0549.
Trujillo-Ortega, M.E., Beltran-Figueroa, R., Garcia-Hernandez, M.E., Juarez-Ramirez, M.,
Sotomayor-Gonzalez, A., Hernandez-Villegas, E.N., Becerra-Hernandez, J.F.,
Sarmiento-Silva, R.E., 2016. Isolation and characterization of porcine epidemic diarrhea virus associated with the 2014 disease outbreak in Mexico: case report.
BMC Vet. Res. 12, 132. https://doi.org/10.1186/s12917-016-0763-z.
Wang, S., Fang, L., Fan, H., Jiang, Y., Pan, Y., Luo, R., Zhao, Q., Chen, H., Xiao, S., 2007.
Construction and immunogenicity of pseudotype baculovirus expressing GP5 and M protein of porcine reproductive and respiratory syndrome virus. Vaccine 25,
8220–8227. https://doi.org/10.1016/j.vaccine.2007.09.069.
Xiao, S., Chen, H., Fang, L., Liu, C., Zhang, H., Jiang, Y., Hong, W., 2004. Comparison of immune responses and protective efficacy of suicidal DNA vaccine and conventional
DNA vaccine encoding glycoprotein C of pseudorabies virus in mice. Vaccine 22,
345–351. https://doi.org/10.1016/j.vaccine.2003.08.010.
Yang, D.Q., Ge, F.F., Ju, H.B., Wang, J., Liu, J., Ning, K., Liu, P.H., Zhou, J.P., Sun, Q.Y.,
2014. Whole-genome analysis of porcine epidemic diarrhea virus (PEDV) from eastern China. Arch. Virol. 159, 2777–2785. https://doi.org/10.1007/s00705-014- 2102-7.
Zhang, L., Liu, X., Zhang, Q., Zhou, P., Fang, Y., Dong, Z., Zhao, D., Li, W., Feng, J.,
Zhang, Y., Wang, Y., 2019. Biological characterization and pathogenicity of a newly isolated Chinese highly virulent genotype GIIa porcine epidemic diarrhea virus strain. Arch. Virol. 164, 1287–1295. https://doi.org/10.1007/s00705-019-04167-3.
D. Shi et al.