Protein analysis of exon 8 mutation in iduronate 2-sulfatase gene in mucopolysaccharidosis type II patients in Indonesia

Mucopolysaccharidosis II (MPS II, Hunter syndrome) is a rare, X-linked, recessive lysosomal storage disease caused by a deficiency of enzyme iduronate-2-sulfatase (I2S), encoded by IDS gene. I2S enzyme catalyzes the degradation of glycosaminoglycans (GAGs), such as dermatan sulfate (DS) and heparan sulfate (HS). Deficiency of I2S leads to the accumulation of these glycosaminoglycans in the tissues. Exon-specific analyses of IDS exon 8 has been analyzed from eight MPS II Indonesian patients at Cipto Mangunkusumo National Referral Hospital, Jakarta, Indonesia. Identification of IDS exon 8 was performed using PCR and sequencing-based methods. One previously reported deletion mutation (c.1023delA) of exon 8 was identified amongst the patients, causing a frameshift in the corresponding amino acid sequence (p.Glu341AspfsTer19), observed in one patients. This mutation causes a reduction in the number of amino acids and changes in the structure of 3D proteins. There is no reduction and change in the active site of the protein, but the termination that occurs at the 359th codon causes a reduction of two glycosylation sites. This study provides the first mutation analysis of exon 8 of IDS, and successfully identified mutations within the IDS gene that may be associated with MPS II. This supports the feasibility of early diagnosis and screening for MPS II in the future.

Background:

Mucopolysaccharidosis II (MPS II, Hunter syndrome) is a rare, X-linked, recessive lysosomal storage disease caused by a deficiency of enzyme iduronate-2-sulfatase (I2S), encoded by IDS gene. I2S enzyme catalyzes the degradation of glycosaminoglycans (GAGs), such as dermatan sulfate (DS) and heparan sulfate (HS). Deficiency of I2S leads to the accumulation of these glycosaminoglycans in the tissues. Exon-specific analyses of IDS exon 8 has been analyzed from eight MPS II Indonesian patients at Cipto Mangunkusumo National Referral Hospital, Jakarta, Indonesia.

IDS is 28 kb in length and contains nine exons [3]. Mutation of IDS causes disruption of lysosomal iduronate-2-sulfatase (IDS) enzyme function, which required for the degradation of GAGs: dermatan sulfate and heparan sulfate. Impairment of IDS enzyme activity results in the accumulation of HS and DS, resulting in the development of MPS II phenotypes.

Methods:

We analyzed DNA from eight blood samples of Indonesian MPS II patients from the Cipto Mangunkusumo National Referral Hospital along with 50 samples from normal individuals. Genomic DNA was isolated using a Blood/Cell DNA Mini Kit from Geneaid. Polymerase chain reaction (PCR) of IDS exon 8 was done with specific primers designed in this study (Forward Primer: TTCATTTTCTGTCATTCTGTGC and Reverse Primer: TGTCAAGCAATATCATTTCAGCA). PCR product was sequenced to find the variation in IDS gene of each samples. The novelty of variations in IDS gene were checked in database and recent publication. Based on the arrangement of amino acids, homology of the 3D structure of I2S proteins was carried out with the SWISS MODEL and Protein Data Bank (PDB) devices. The homology results will be used to make the 3D structure of the protein for each patient and analyzed using a Python Molecular Viewer (PMV) device to determine changes in the structure of protein molecules due to mutations.

Results:

Result of exon 8 IDS gene sequence analysis from eight MPS II patients and 50 normal controls come out with one mutations. The mutation is c.1023delA that present in all eight MPS II patients.

BioEdit software was used to predict the corresponding amino acid sequences of each of the exon 8 regions, allowing amino acid changes caused by the observed mutations to be identified. Deletion mutation c.1023delA resulted in a frameshift mutation in the amino acid sequence (p.Glu341AspfsTer19).

The mutation causes a reduction in the number of amino acids to 358 amino acids. In addition, the termination that occurs at the 359th codon causes a reduction of two glycosylation sites (Asn513 and Asn537). These mutations do not affect the active site of the I2S enzyme protein.

Data Summary:

Eight MPS II patients and 50 normal controls were analyzed. One mutation, c.1023delA, was present in all eight MPS II patients. This deletion causes a frameshift mutation p.Glu341AspfsTer19, reducing the number of amino acids to 358 and causing loss of two glycosylation sites (Asn513 and Asn537).

Conclusions:

Based on 3D modelling of protein, we conclude that the c.1023delA deletion mutation affect the severity of MPS II disease [6]. The loss of two glycosylation sites causes post-translational protein modification does not occur so well that the enzyme activity will be disrupted. In addition, changes in the structure of protein that appears also becomes a factor in decreasing the value of enzyme activity which affects the build-up of heparan sulfate and dermatan sulfate.

Practical Significance:

This study provides the first mutation analysis of exon 8 of IDS, and successfully identified mutations within the IDS gene that may be associated with MPS II. This supports the feasibility of early diagnosis and screening for MPS II in the future.